Time To Get….nsfw…. *proceeds To Commit Multiple Osha Violations*

time to get….nsfw…. *proceeds to commit multiple osha violations*

More Posts from Quinn-loves-liam and Others

4 years ago

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

4 years ago

Get to know me asks

Nickname?

Hair color?

Eye color?

Height?

Any siblings?

Any pets?

Favorite color?

Favorite number?

Favorite animal?

Any phobias?

Favorite game?

Sexuality?

Gender identity?

Favorite subject in school?

Any piercings?

Any tattoos?

Do you like sports?

What are your hobbies?

Favorite music genre?

Favorite book?

Favorite show?

Favorite movie?

Describe one thing about your physical appearance

Describe one thing about your identity

Favorite flower?

Favorite food?

Something you’re good at?

Something you wish you were better at?

Something you spend a lot of time doing?

A hobby you have?

4 years ago

Some days i wish i understood bills enough to help out with them- but as it stands im as clueless as Giovanni from Epithet erased... i just wanna help make things easier for my partner :c


Tags
1 year ago
Make Sure You Trim Your Rat Mans Nails So He Doesn't Scratch Himself!!!!!!

Make sure you trim your rat mans nails so he doesn't scratch himself!!!!!!

4 years ago

so dam adorable

Ramsey Rat, theres nothing else to it

Ramsey Rat, Theres Nothing Else To It
4 years ago

got an idea now.... saving this for later

Saitamas Always Going Thru It…

saitamas always going thru it…

4 years ago

you learn something new every day :/ fuck

The orphans of London can rest safe knowing that they are no longer at risk of being harvested for organs to keep Phillip alive

4 years ago
No Purple But They Had Facial Hair 9/10 Picrew @l0stl1am Try This One Out I Think You Might Like It

no purple but they had facial hair 9/10 picrew @l0stl1am try this one out i think you might like it

Picrew!

Picrew!

Use this to make yourself, and tag a friend!

3 years ago

Your Boyfriend comic strip!

please read at your own risk! spelling errors fixed I am so sorry.

Your Boyfriend Comic Strip!
  • heart-a-holic
    heart-a-holic liked this · 4 months ago
  • princemolder
    princemolder liked this · 6 months ago
  • cthulhu-lulu
    cthulhu-lulu reblogged this · 6 months ago
  • thebluedrag0n
    thebluedrag0n reblogged this · 8 months ago
  • thebluedrag0n
    thebluedrag0n liked this · 8 months ago
  • whatthefuckisarelationship
    whatthefuckisarelationship liked this · 8 months ago
  • pricklyshark
    pricklyshark liked this · 8 months ago
  • touch-starved-lurker
    touch-starved-lurker liked this · 8 months ago
  • its-liammm
    its-liammm liked this · 8 months ago
  • dont-look-me-in-the-eye
    dont-look-me-in-the-eye liked this · 8 months ago
  • ivydbomb
    ivydbomb reblogged this · 8 months ago
  • ivydbomb
    ivydbomb liked this · 8 months ago
  • the-thing-of-worms
    the-thing-of-worms reblogged this · 8 months ago
  • gayoticbeing
    gayoticbeing reblogged this · 8 months ago
  • benjis-art-and-reblogs
    benjis-art-and-reblogs liked this · 8 months ago
  • foxglove-tea
    foxglove-tea liked this · 8 months ago
  • mildlybizarrecorvid
    mildlybizarrecorvid liked this · 8 months ago
  • watchtimeticktock
    watchtimeticktock reblogged this · 8 months ago
  • watchtimeticktock
    watchtimeticktock liked this · 8 months ago
  • b1tterbiscuit7
    b1tterbiscuit7 liked this · 8 months ago
  • abstinentce
    abstinentce liked this · 8 months ago
  • aromantic-isopod
    aromantic-isopod liked this · 8 months ago
  • aroacejedi
    aroacejedi reblogged this · 8 months ago
  • amediocregamer
    amediocregamer liked this · 8 months ago
  • long-form-contentment
    long-form-contentment reblogged this · 8 months ago
  • gamefrog51
    gamefrog51 reblogged this · 8 months ago
  • nobodywasneverhere
    nobodywasneverhere reblogged this · 8 months ago
  • nobodywasneverhere
    nobodywasneverhere liked this · 8 months ago
  • irusanw4
    irusanw4 reblogged this · 8 months ago
  • thatoneacerobot
    thatoneacerobot liked this · 8 months ago
  • funkytrashcan
    funkytrashcan reblogged this · 8 months ago
  • aromanticsky
    aromanticsky liked this · 8 months ago
  • i-have-a-coffee-problem
    i-have-a-coffee-problem reblogged this · 8 months ago
  • i-have-a-coffee-problem
    i-have-a-coffee-problem liked this · 8 months ago
  • tameable50
    tameable50 reblogged this · 8 months ago
  • dandelions-arent-weeds
    dandelions-arent-weeds reblogged this · 8 months ago
  • dandelions-arent-weeds
    dandelions-arent-weeds liked this · 8 months ago
  • bored-dromaeosaur
    bored-dromaeosaur reblogged this · 8 months ago
  • goblinofthelaboratory
    goblinofthelaboratory reblogged this · 8 months ago
  • bewareofthegoatman
    bewareofthegoatman reblogged this · 8 months ago
  • bewareofthegoatman
    bewareofthegoatman liked this · 8 months ago
  • keter-kan
    keter-kan liked this · 8 months ago
  • the-ace-of-dimes
    the-ace-of-dimes reblogged this · 8 months ago
  • iloveyapping
    iloveyapping liked this · 8 months ago
quinn-loves-liam - [insert meme here]
[insert meme here]

21, any pronounds really but i prefer they/them or he/him. Proud posessive polyamorous pansexual person.

284 posts

Explore Tumblr Blog
Search Through Tumblr Tags